Does anyone indicates a site or a book of "Meta-analysis for dummies"?

24 February 2021 2,755 4 View

Is there any solar electric power plant having the concentrated photovoltaic modules?

The solar photovoltaic (PV) power plant uses commercial (non-concentrated) PV modules which are quite simple in design and reliable. They can work on fixed orientation and don't need the moving...

16 February 2021 3,796 9 View

Are there any differences between setting automatic or manual number of measurements in DLS?

When doing measurements in DLS (either size or zeta potential), I have the option to input an automatic number of measurements or to set it manually. My question is: is there a drawback in...

08 February 2021 9,423 6 View

Control in microstructure with growth inhibitor?

Dear researchers, I wish to understand the role of grain growth inhibitor in controlling the microstructure of the ceramic pellet. How it controls the growth? Also, I wish to know the grain...

15 January 2021 3,859 3 View

Does behavior (shy vs bold; rare vs abundant) and flock size (small vs large) of bird species play role in niche partitioning among sympatric species?

Sympatric birds may avoid competition via multiple strategies - by different activity period, different diet, different microhabitat etc. Has any one looked into behavior of sympatric birds as...

11 January 2021 9,600 1 View

Buckling of Smart composite plates using FEM ( MATLAB code)?

Can anyone help me with the FEM coding for Buckling of composite plates using the FSDT or HSDT - Source or the helping material (textbook, research paper etc) - Geometric stiffness matrix...

03 January 2021 3,059 3 View

Google Reveals Major Hidden Weakness In Machine Learning, What are your observations on the following article?

Deep learning algorithms are prone to a previously unknown problem, say a team of computer scientists at...

14 December 2020 4,163 4 View

Do you think the people can change his activity behavior just because have a chronic disease?

Along several years specialist study the physical activity, bur why not everybody meke changes.

03 December 2020 2,191 3 View

Optimization technique in ball mill?

Hi all, I wish to know about a common problem faced by most of the researchers who are dealing with ceramic materials that my ceramic powder is sticking with the balls after the operation. can...

02 December 2020 8,232 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

I got 02 moderator values defining Johnson-Neyman significance regions. Is it an error?

Hi everyone, I am conducting research for my Master's thesis. I am using PROCESS by Johnson-Neyman to analyze my Moderator model. I test the relationship between Public Service Motivation and...

03 March 2021 2,350 2 View

Logistical regression using SPSS for a dichotomous dependent variable, with an independent variable of 1, 2, 5 and 10 seconds?

I have an experiment with 28 participants The independent variable is the times 1, 2, 5, and 10 used as the cross hairs during a task These 4 times were tested using 4 different blocks, each...

03 March 2021 9,692 2 View

What degree of missing data in a particular case/participant results in Expectation-Maximisation no longer working?

I'm dealing with a mediation model and am using the PROCESS module in SPSS. Due to SPSS and PROCESS being limited in the imputation methods - being unable to handle multiple imputation - the other...

02 March 2021 4,362 1 View

Do I need to do linear regression before running mediation analysis using PROCESS MACRO by Hayes ?

I just wanted to check if I need to run a linear regression separately if I am using PROCESS MACRO to run mediation analysis. Thank you.

02 March 2021 4,359 3 View

Is There Any Feasible Method To Test Fluorescent Compounds Other Than Fluorescence Spectrometers ??

Is There Any Feasible Method To Test The Efficiency Of Fluorescent Compounds Other Than UV Spectrometers ? Suggestions Would Be Appreciated !

02 March 2021 5,785 3 View

How to choose ANN number of hidden layers and nodes?

Hello, Could you please share any interesting research explaining how to choose the number of hidden layers and nodes per layer in case of regression problems using ANN? Thank you, any help would...

01 March 2021 6,200 3 View

Can anyone provide the Support vector regression code structure of LIBSVM MATLAB or python ?

Please, if Gaussian Parameter optimization is possible in this code structure

28 February 2021 278 3 View

How could I take into consideration the weights of observation in a system of seemingly unrelated regressions (SUR) in rstudio?

I build a model of 4 regression equations (probit and OLS) in R studio. I need to take the weights of observations into consideration. While it is simple to do so for every regression equation,...

27 February 2021 1,233 1 View

Mixed ANOVA - help?

I'm currently working on a piece which asks to conduct an ANOVA - looking at the effect of sporting group (2 levels), and exercise trials (two trials with six levels). I've computed this all...

27 February 2021 9,626 4 View

VIF very high, but correlation is low and coefficient is significant. Which one whould I choose?

Hello. I have a question whether if my coefficients (statistically significant) would be valid when VIFs are really high. In my model, there are independent variables(IV), moderating variables...

26 February 2021 956 13 View