I want know is there any code/program which give the count of Vehicle (Moving object) in matlab?

25 December 2020 1 3K Report

I have completed my noise monitoring and videography ( for traffic volume count) survey ,And I just want to count vehicles moving on road , So let me know is there any code or program in MATLAB to count moving object from a video?

Vinita Shah

You can check following links.

http://www.mathworks.com/products/computer-vision/code-examples.html

https://www.mathworks.com/matlabcentral/answers/290445-how-to-count-number-cars-bikes-in-a-image-using-matlab#answer_226769

Badges
Science topic

More Ramesh Ranpise's questions See All

One way or Two way ANOVA?

Dear All, I have one dependent variable and three independent variables and wanted to apply ANOVA as a measurement. However these variables do not have any levels or categories. Please suggest...

01 December 2020 2,069 8 View

How to Identify the tuples fall in False Negatives in Confusion Matrix?

All metrics to measure predictability are simply depend(Negatively) on False Negatives(FN) as well as False Positives(FP). Is there any way of knowing who(Instances/Tuples) went to FN basket as...

08 November 2020 192 3 View

Here we are fabricating Perovskite solar cell in air atmosphere, even for standard cell also not getting PCE more than 1.5% but in reports PCE is 15%?

Hi, I am PhD student working on Perovskite solar cells (PSCs), I have fabricated standard cell (FTO/C-TiO2/M-TiO2/CH3NH3PbI3/Spiro-OmeTAD/Ag) in air atmosphere. but i am not getting any...

06 October 2020 8,168 8 View

I want to simulate a VAR model. How do I choose the coefficients to ensure stability?

I know how to compute eigenvalues to test stability. The question If i have for example a 10 node model with 5 lags, how do i choose stable parameters without just guessing.

06 October 2020 5,238 6 View

Best techniques available for the VOCs adsorption by MOFs?

I am very new to MOF-field. I really need your help, can anybody please suggest me which is a simple and best technique to do VOCs adsorption studies for MOFs? In our lab we have GC-MS and my big...

05 October 2020 8,874 2 View

The ratio of hypocholesterolemic/hypercholesterolemic (h/H) fatty acids?

The following equation is generally used for the calculations of the ratio of hypocholesterolemic /hypercholesterolemic (h/H) fatty acids, or h/H fatty acids index (Santos-Silva et al. 2002;...

24 September 2020 9,939 5 View

Stagetips for desalting small molecules (not peptides)?

I work with derivatized neurotransmitter molecules. I was using C-18 SPE cartridges previously for desalting them before LC-MS, but now I would like to adopt in-house made stagetips. These are a...

22 September 2020 4,854 6 View

Is there any quantitative measure of Interdependence between different data-variables ?

In my observed data I have different data variables(12 in Number) , Let say X1,X2......X12..I want know ,How one data variable influence the value of another data variable.. is this...

11 May 2020 2,968 1 View

How to design a Spaceborne Antenna for HEO (Highly elliptical orbit) satellites? What types of Antenna are useful for this purpose?

29 April 2020 9,604 1 View

Will three missing nucleotides on the 3' end of the forward primer result in no annealing?

Hello everyone, I ordered forward and reverse primers for oligo annealing for guided RNA cloning. Instead of this primer (5' CTTCGCTAGAGGCGTGGCCAGGGG 3'), I ordered this...

25 March 2020 551 5 View

How to code open-ended questions in SPSS?

Hello all, In SPSS I am going to code 2 open-ended questions. I have already read all the answers and I made a list of the most important categories to which I can code the answers. This question...

02 March 2021 1,757 4 View

Timeout error!! Processor in the loop (PIL) using STM32F4 Matlab 2018a?

Dear Researchers I am trying to perform a PIL simulation using STM32F4 Discovery board and comunication serial USB TO TTL. During simulation I receive the following timeout error: An error...

01 March 2021 2,327 1 View

How to eliminate Steady state error from Reinforcement learning genetic algorithm code?

The following code (see 1st 2 images attached) is used to produce PID controller values that are designed to control the system (G). The code finds the PID controller values (noted as k) by using...

28 February 2021 6,560 14 View

How to prevent ANFIS Model from negative prediction values in MATLAB?

I have input and output data set for "ANFIS modeling in MATLAB", and I am getting some negative predicted values of output in testing. However, the predicted values of output in training are...

28 February 2021 3,459 3 View

How can we simulate an hyperelastic-viscoelastic behavor with Ansys APDL?

I am working on modeling and simulation of biomecanical material behaviour, I have succeded on simulating skin using anisotropic hyperelastic material, on APDL and in our lab's finite element...

28 February 2021 552 3 View

How could I process data in RCT to include it in meta-analysis?

I'm in the process of doing a meta-analysis and have encountered some problems with the RCT data. One of my outcom is muscle strength. In one study, I have three different measurements of muscle...

25 February 2021 7,603 3 View

How does an AC-DC power supply Flyback Converter Based USB Charger Model using Matlab/Simulink looks like?

I am required to learn about Flyback converters and I got stuck not knowing to full design of the power supply flyback converter Based USB Charger Model using Simulink, especially the design model...

25 February 2021 5,435 2 View

Modeling viscosity using model of Chung?

Hello, As part of simulation of gases mixture and water, I need to calculate viscosity of the fluid components and I am using relationships proposed by Chung et al. (1988). The irony is while I...

25 February 2021 8,053 5 View

Please. Could you help be in implementing Fractal Discrete Cosine Transform algorithm in Matlab?

I do need the Matlab code of Fractal Discrete Cosine Transform (FDCT). Can anyone who has already implement this code, help me with the implementation of this transform?

24 February 2021 5,602 2 View

D2D implementation in Matlab in Vienna LTE software?

Hi Hope you are well. Can you please share your code for D2D implementation in Matlab. I want to implement D2D in Matlab based Vienna simulator and struggling to deploy D2D. Thanks

24 February 2021 9,378 3 View