Ask for help about wannier90, hopping matrix elements are not complex conjugate?

Dear All, I calculate band structure and hopping matrix of monolayer Graphene by using wannier90-2.0.1. There are two atoms in one unit cell, the following is input information : INCAR :...

26 February 2020 4,885 1 View

How to calibrate a T/C CO2 sensor in an air-jacketed CO2 incubator without an independent CO2 sensor?

I have an air-jacketed CO2 incubator and I need to calibrate its thermal conductivity CO2 sensor. However, I do not have a CO2 sensor that is independent of the incubator to measure the CO2...

31 January 2020 8,758 1 View

What is a good procedure to identify if the CO2 incubator is the source of contamination in my cell cultures?

I have read some vague descriptions about how to screen the CO2 incubator as the source of contamination. I saw recommendations to leave a plate of cell culture media in the incubator and view it...

12 January 2020 8,639 2 View

How to euthanized humanely small reptile using alcoholic solution? Is this thing appropriate ?

How to euthanized small reptile using alcoholic solution? Some of the reference said that pentobarbital are good solution. However in field practice i have difficulties on availability and...

15 November 2019 1,375 6 View

Have problems in insert sgRNA into lenticrispr v2 vector?

my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol,...

28 December 2018 4,592 3 View

Sensor zenith angle value of Landsat 8 data?

To apply MCSST algorithm for retrieving sea surface temperature data from Landsat 8 I need a 'sensor zenith angle' value. Unfortunately in the Landsat 8 metadata file (.MTL) only available sun...

13 February 2017 3,690 3 View

Can I run a multiple regression with 150 cases altogether with hormones as independent variables to predict birth weight?

12 October 2016 6,081 4 View

How to make a modeling of multi- cell batteries in series or parallel?

I have done a simulation modeling of single cell battery. And then I want to raise the value of the battery voltage by adding some more single cell-batteries modelling in series, the result was...

10 August 2016 8,246 3 View

Does interstitial growth of cartilage give rise to isogenic groups of chondrocytes as a final aim?

07 April 2015 7,139 5 View

What is the proper stimulation point (dosage and time) for VSMC proliferation?

20 February 2015 2,729 1 View

RIA. How to measure?

When you use RIA, with a control the unknown sample with antibodies, you bare in mind the binding sites of the antibodies. However you still need to measure labelled antigen (radioactive) and not...

28 February 2021 2,133 3 View

How to Eliminate cosine error and abbe error in LASER measurement system(for example Rhenishaw XL80)?

I like to do project in laser measurement system. My objective is to eliminate or reduce the cosine error, abbe error in Laser measurement system. I have Rhenishaw XL80 system. Please tell the...

28 February 2021 4,890 3 View

How to measure angle between laser travel path and machine axis in Laser Measurement system?

25 February 2021 1,987 3 View

Could the "incoming radiation (net radiation)" values be negative?

Could the "incoming solar radiation" values be negative? What is the difference between "global solar radiation" and "incoming solar radiation"? Which one might be measured negative values?

21 February 2021 7,726 9 View

Can I follow Researchers from Teaching and testing areas?

I want Researchers from Educational Measurement and Evaluation, relating to teaching, learning , academic performance and test validation

18 February 2021 4,757 13 View

What is the paradoxical effect of VINASSE in terms of low pH (<4) and high EC (>50dS/m)? What is its impact on soil properties and crop growth?

What is the paradoxical effect of VINASSE in terms of low pH (50dS/m)? What is its impact on soil properties and crop growth?

15 February 2021 3,142 6 View

How to determine measurement uncertainty of a mass balance?

Hi everyone, I work at a factory plant where they use a mass balance. The problem is that there is an huge difference between the input and output of one element. There are several people working...

10 February 2021 5,764 3 View

Wave velocity and rock density paradox?

Practically it is known that seismic velocity increases as rock density increases, why then does the wave velocity equation involving elastic moduli and density indicate that velocity is inversely...

09 February 2021 1,843 3 View

Translating two biomarkers to the same scale??

Hello researchers, I was wondering if anyone had experience in the following: I would like to translate two separate continuous biomarkers (A and B), that are mechanistically linked to each...

25 January 2021 2,107 3 View

Similarity between these two waveform? Similarity in terms of Shape?

Hi, These are the outputs generated by a system. Green-colored (nr) is desired output, while the system generates Red-colored (nf). I also have a dataset in CSV file. For this waveform, What...

21 January 2021 929 2 View