Hi Mr Bhashimi,

First of all, you have to do a good bibliographic searching : research paper about H1N1, what each research work found as results, and to compare the results found by each team. At the end you can select the most interesting primers.

Reagrds,

Thank you.  I searched for the primer sequences, but couldn't get apt primers for sequencing of complete HA and NA gene. Please if any one has the correct link, share it. 

Hi Nandhini,

Several sets are available online. Try these primers. I use them and they work. 

Uni-A/HA-For  TATTCGTCTCAGGGAGCAAAAGCAGGGG

Uni-A/HA-Rev  ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT

Uni-A/NA-For  TATTCGTCTCAGGGAGCAAAAGCAGGAGT

Uni-A/NA-Rev  ATATGGTCTCGTATTAGTAGAAACAAGGAGTTTTT

http://download.thelancet.com/flatcontentassets/H1N1-flu/virology/virology-26.pdf

http://wwwnc.cdc.gov/eid/article/20/11/14-0897-techapp1.pdf

http://www.ncbi.nlm.nih.gov/pubmed/11811679

 Thank you Anwar M Hashem.  I am checking those primer sequences that you have sent using insilico pcr.  Will get back to you . 

Dear Anwar M Hashem, The primers you have sent is not working in insilico pcr ! Is it working for your complete HA and NA sequencing. 

Dear Anwar M Hashem,

What is the basepair size of your pcr end product of HA and NA using those primers you mentioned ?

These are universal fluA primers. They are for the 5' and 3' untranslated regions. They should work. try them in silico with full segments

Dear Anwar M Hashem,

I tried insilico of HA primers (you have given) with complete gene of HA ie., 1710 bp. Still it is not showing any results of amplification! similar failure with NA gene too which is 1410 bp. Can you help me to clear this problem?

Inoue, E., Wang, X., Osawa, Y., & Okazaki, K. (2010). Full genomic amplification and subtyping of influenza A virus using a single set of universal primers. Microbiology and Immunology, 54(3), 129–34. doi:10.1111/j.1348-0421.2009.00193.x

Thank you for sharing the paper Dr. Joshua M Klonoski.  The protocol in the paper is not just conventional pcr which i need to do before sequencing.  I need primer sequences to amplify complete HA and NA separately by conventional pcr before giving the amplicons for sequencing. 

Hello I have tried same primers on flu RNA ,but m getting less sized bands ,can some one tell me the PCR conditions specifically the annealing temperatures for HA universal primers

Thanks to @ Bingqian Qu and combining multiple threads @ Nandhini Bhashini , @ Emmanuel Bunuma and @ Liming Zhang

Hoffmann, E., Stech, J., Guan, Y., Webster, R. G., & Perez, D. R. (2001). Universal primer set for the full-length amplification of all influenza A viruses. Archives of Virology, 146(12), 2275–2289. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11811679