Use its4 and its5 with annealing temp of 52c.

Its4: tcctccgcttattgatatgc

its5: ggaagtaaaagtcgtaacaagg

EUK329 (TGATCCTTCYGCAGGTTCAC) and U18SF (ACCTGGTTGATCCTGCCAG) worked well for us and gave a 1700bp fragment. have a look at the attached file!

Thanks a lot all of you :)

I have used ITS and it worked well for me. You can also use primers targeting 28s, it really works well for me. In case of qualitative identification 28s works good, and for sequencing ITS works for broad level identification.

Below is the reference for 28s

Molecular probe for diagnosis of fungal infection, Sandhu GS Kline BC Stocjkman L Roberts GD J Clinical Microbiology 1995 33(11):2913-2919

I usually use the SS5/SS3 universal primers for SSU without problem, ITS4/ITS5 for ITS and LR0R/LR5 for the D1-D2-D3 region of the LSU.

Check the sample concentration. DNA extractions from fungi may carry quite few inhibitors. Be sure you have a working positive control, or the problem may be something else and not the primers.

I did characterization for about 50 fungal strains isolated from soil, using two different sets of primers. PN3 f and PN10 r & ITS1 f and ITS4 r , showed good amplification with all strains. And also change (if you are using) Taq Pol with some high fidelity and Proof Reading enzyme like PR Polymerase, HoT Start.