Dear microalgae researcher,
We have a microalgae culture obtained from a domestic fish tank. We are testing the culture in a photobioreactor prototype in our University. Here I attached some pictures taken at the beginning of the cultivation. At this initial stage, we also observed some contamination by other algae. At the end of the process we obtained a seemingly pure culture comprised by the green spherical algae only. Could you please have a look at the pictures and tell me your opinion about the type of algae? In addition, what is your advice so that I can report the identification of this algae in a scientific paper? Do I need to follow a specific protocol?
I very much appreciate your help.
Best regards,
Rogelio Valadez.
Dear Dr.Rogelio,
I could identify two micro-algal cells namely Chlorella sp and Euglena sp. from the photomicrographs you provided.
Good luck for your project.
I can see Chlorella-like (Chlorococcum-like cells) as well as Euglena spp. in your sample. I hope you can have a better photomicrograph so that we can speciate the algae.
Dear Dr. Jackson, thank you very much for your answer. As you said, we were thinking that the spherical green micralgae was Chlorella vulgaris. Do you have any suggestion about the procedure I can follow to have an identification of the algae at a species level or at least at a genus level so that I can report it in a peer-review journal?
Dear Dr. Jackson
In the second photo it´s possible to identify a Chlorella (rounded cells with cup-shaped chloroplast and one pyrenoid) and some other elongated cells with pointed ends that it´s necessary a better photo or it will be impossible to identify. I can´t see any Euglena.
The first photo is not possible to identify without a clear and better images. Sorry, Célia Sant´Anna
If I were you would try a little bit harder to get the pure culture (the chlorella-like on will form a colony on agar plate so easy to isolate). After having a pure culture, do DNA extraction then use universal 18S RNA primer for PCR and follow by DNA sequencing.
In my lab I found these pairs work quite well.
107F: (5' CGAATGGCTCATTAAAT 3') 1700R: 5’ CCGAAGTCTTCACCAGCACATC 3’
ChloroF: TGG CCT ATC TTG TTG GTC TGT
ChloroR : GAA TCA ACC TGA CAA GGC AAC
Ref:
1. Molecular evidence for a diverse green algal community growing in the hair of sloths and a specific association with Trichophilus welckeri (Chlorophyta, Ulvophyceae)
2. DNA barcoding of select freshwater and marine red algae
(Rhodophyta)
Hope this help :)
Dear Thanyanan;
Thank you very much for your thoughtful response. Yes, as you suggest we will aim at the isolation and molecular identification of the strain. I thought that an accurate morphological identification was possible. Regards,
Rogelio.
The first photo has low quality. I suggest you search for some Chlorococcum species.
In the second photo we can see Chlorella sp. and a fusiform cell that is not Euglena. There is not a species of Euglena as small as a Chlorella cells. It is probably a chlorophyte, but you need better images to identify it.
Hi, In order to identify microalgae upto species level, you can very well use the standard monographs and websites. The following are some of the Monographs:
Title, Cyanophyta Volume 2 of I.C.A.R. monographs on algae. Author, T. V. Desikachary. Publisher, Indian Council of Agriculture Research, 1959. Original from, the University of California. Digitized, Mar 9, 2009. Length, 686 pages.
Title, A Monograph of British Desmidiacea, by West and West (5 volumes)
Contributions towards a Monograph of the Genus Euglena. 1956. (Nov.Act.Leopold.,NF 125). 44 Fig. 168 S. gr8vo. Broschiert.
Hope this may helpful.
Thank you very much for the information Maheswari. I hope some of these monographs are available online. Will have a look at it. Regards.
I have been studying chlorella microalgae for 4 years now and I can say for sure that in the second photo besides chlorella cells there are paramecia and microbes