Is there any solar electric power plant having the concentrated photovoltaic modules?

The solar photovoltaic (PV) power plant uses commercial (non-concentrated) PV modules which are quite simple in design and reliable. They can work on fixed orientation and don't need the moving...

16 February 2021 3,796 9 View

Statistical methods for comparing gene expression curves?

Hi all, I have generated two gene expression curves by measuring bioluminescence every 10 mins for 12 hrs. These curves tend to overlap at at some time points, while a difference can be seen at...

02 February 2021 2,613 7 View

Control in microstructure with growth inhibitor?

Dear researchers, I wish to understand the role of grain growth inhibitor in controlling the microstructure of the ceramic pellet. How it controls the growth? Also, I wish to know the grain...

15 January 2021 3,859 3 View

In which solvent dissolve silver nanoparticles for XRD pattern study through NMR ?

The silver nanoparticles, which are solid form and I want to study the XRD pattern of this nanoparticles by Nuclear Magnetic Resonance (NMR), so I asked which solvent are used for dissolve of...

13 January 2021 3,434 4 View

Does behavior (shy vs bold; rare vs abundant) and flock size (small vs large) of bird species play role in niche partitioning among sympatric species?

Sympatric birds may avoid competition via multiple strategies - by different activity period, different diet, different microhabitat etc. Has any one looked into behavior of sympatric birds as...

11 January 2021 9,600 1 View

Calculate the Strain at a Node in the Turbine Blade FE Model?

Hello Team, I would like to calculate the strain at a node #5 in a direction (l1,m1,n1) in the turbine blade FE model as shown. This node is connected with four elelemnts (#1,#2,#3,#4) and I have...

11 January 2021 7,702 3 View

One invention granted for the US and European patent will be counted as one patent or 2 patents for CV writing?

One invention granted for the US and European patent will be counted as one patent or 2 patents for CV writing?

05 January 2021 8,135 4 View

How to optimize a structure for excited state when there is a bond breaking during optimization in gaussian?

In Gausssian, I have tried to reoptimize that structure by freezing the bond which is breaking in excited state during optimization. Before freezing the bond i have already tried scf = xqc and scf...

20 December 2020 8,444 3 View

Optimization technique in ball mill?

Hi all, I wish to know about a common problem faced by most of the researchers who are dealing with ceramic materials that my ceramic powder is sticking with the balls after the operation. can...

02 December 2020 8,232 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

Guidelines for survey (question type) analysis?

Hi. Please tell me what guidelines should i need to follow for questionaries' type research work in India. It is not hospital based work, we are conduction basic institutional based qualitative...

03 March 2021 2,037 3 View

How to access MSCI KLD Stats and Sustainalytics?

Hello all, I'm currently working on my undergraduate thesis and I'm having difficulties trying to access KLD Stats and Sustainalytics because my campus Airlangga University and apparently other...

02 March 2021 8,525 1 View

Ideas for Phd's Thesis on pricing (Marketing)?

Hi everyone, I'm studying Marketing and I would like to write my PhD thesis on the topic of pricing. Any specific ideas?

02 March 2021 9,706 5 View

Waters 2707 HPLC autosampler problem?

I am using a 2707 waters HPLC device. When I try to inject a sample, it says missing plate or rack. I changed the needle and calibrated its position but I still get the same problem. I even get...

02 March 2021 1,408 1 View

No title

02 March 2021 3,060 3 View

No title

02 March 2021 932 1 View

How to code open-ended questions in SPSS?

Hello all, In SPSS I am going to code 2 open-ended questions. I have already read all the answers and I made a list of the most important categories to which I can code the answers. This question...

02 March 2021 1,757 4 View

Should we change media after1st 6hrs after plating HUVEC bought from INVITROGEN?it's not recomended by invitrogen.Will DMSO present in stock matter?

We have HUVEC bought from Invitrogen. Cat no -C-003-5c. while first plating the cells we have bought the protocol suggests not to centrifuge the cell with media to remove the DMSO. Should we...

02 March 2021 3,713 2 View

How to normalise data on OPM package from R Studio ?

Good afternoon, I recently used OmniLog from BIOLOG for my experimentations : I tested the metabolism of different strains on 2 types of plates. I have 16 strains of 3 different groups...

02 March 2021 3,584 1 View

APA 7th In-Text citations with two references with three authors with the same surname, but four different author?

I have an issue with APA 7th in-text citation. II have two papers where the first three authors are the same, and the fourth is different. I am using the Mendeley desktop app, and automatically it...

02 March 2021 790 3 View