Shyam Jee

1 Questions 3 Answers 0 Followers

Questions related from Shyam Jee

I have a question regarding to selection of antisense oligo nucleotide.

Suppose this is the designed antisense oligo for Nicotiana tabacum (NtVI A3.6 722L20 5’CTATCTTCTTCTGCACTTCG 3’). I want to check on target and is their any off-target site.When i am doing...

26 May 2017 3,368 2 View