6 Questions 2 Answers 0 Followers
Questions related from Hungjen Wu
This is my first time doing this and I would like some input: -MY first step would be to run a gradient of AS% saturation in crude lysate to observe the min and max req for protein precipitation....
07 July 2019 9,437 3 View
What difference does a slow release of antigens make when attracting antigen presenting cells relative to a fast release? How does it work for different adjuvants? For instance, when vaccine...
10 October 2018 1,168 4 View
For those of you who have used/built VLPs in your research what are some limitations you have observed? What do you think is preventing them from being used universally as vaccines? What are some...
08 August 2018 2,577 5 View
Say I have the following primers for a pyrosequencing of the PROM1 promoter, GenBank: AY275524.1 PYRO1DIR: GAGTAGGTATTTTTATAGGAAATGGATG PYRO1REV: Biotin-AATAAAAAAAATTCCTTAAACATACTCA PYRO 1 SEQ:...
04 April 2018 8,081 3 View
I have two different cell lines here and one has protein A expression while the other one does not. I want to see if the expression of certain genes in one cell line but absent from the other is...
01 January 2018 295 0 View
My experiment involves comparing methylation patterns between 2 different cell lines and initially we used Sanger sequencing. I know now that NGS is more quantitative and hi-res. If I want to...
07 July 2017 9,755 4 View