Hungjen Wu

6 Questions 2 Answers 0 Followers

Questions related from Hungjen Wu

How do you optimize ammonium sulfate precipitation?

This is my first time doing this and I would like some input: -MY first step would be to run a gradient of AS% saturation in crude lysate to observe the min and max req for protein precipitation....

07 July 2019 9,406 3 View

Why is a depot effect necessary for some vaccines?

What difference does a slow release of antigens make when attracting antigen presenting cells relative to a fast release? How does it work for different adjuvants? For instance, when vaccine...

10 October 2018 1,136 4 View

What are some commonly observed problems associated with designing/using virus like particles as vaccines?

For those of you who have used/built VLPs in your research what are some limitations you have observed? What do you think is preventing them from being used universally as vaccines? What are some...

08 August 2018 2,555 5 View

If I have a sequence primers used in pyrosequencing, how what part of a sequence its amplifying? Is this any different from that of Sanger sequencing?

Say I have the following primers for a pyrosequencing of the PROM1 promoter, GenBank: AY275524.1 PYRO1DIR: GAGTAGGTATTTTTATAGGAAATGGATG PYRO1REV: Biotin-AATAAAAAAAATTCCTTAAACATACTCA PYRO 1 SEQ:...

04 April 2018 8,052 3 View

I want to prove that certain genes are assoc. w/ phenomena specific to one cell line. What parameters should I analyze in my microarray data?

I have two different cell lines here and one has protein A expression while the other one does not. I want to see if the expression of certain genes in one cell line but absent from the other is...

01 January 2018 272 0 View

What kind of information can you extract from a bisulfite converted Sanger sequence file that can help you assess chromatogram peak quality?

My experiment involves comparing methylation patterns between 2 different cell lines and initially we used Sanger sequencing. I know now that NGS is more quantitative and hi-res. If I want to...

07 July 2017 9,730 4 View