3 Questions 1 Answers 0 Followers
Questions related from Alok Dubey
Dear Sir/Mam, I am currently cloning my genes and i am short on TA vector if i want to clone TA vector and increase it copy. After isolating these vectors, will it retain its T overhangs?
20 February 2025 6,421 1 View
I have experienced a challenge during my exploration of lncRNA analysis, as it is well-known that there exists a lack of dedicated databases and tools for lncRNA concerning mosquitoes, which can...
12 November 2024 7,253 0 View
Primers designed for dsRNA synthesis: dsPer48F.1: TAATACGACTCACTATAGGGACCCCCTACCCCAACTATCC dsPer48R.1: TAATACGACTCACTATAGGGGTCGCAGAGCATCGTTTCC Control primers (without T7 promoter): AMplicon...
01 January 1970 9,404 1 View