Alok Dubey

3 Questions 1 Answers 0 Followers

Questions related from Alok Dubey

I want to know if i want to increase the number of copy of TA vector by cloning it, will it retain its T overhanga?

Dear Sir/Mam, I am currently cloning my genes and i am short on TA vector if i want to clone TA vector and increase it copy. After isolating these vectors, will it retain its T overhangs?

20 February 2025 6,393 1 View

How to perform lncRNA- miRNA target preediction if there are no data base or specific tools available for mosquito specifically Anopheles stephensi?

I have experienced a challenge during my exploration of lncRNA analysis, as it is well-known that there exists a lack of dedicated databases and tools for lncRNA concerning mosquitoes, which can...

12 November 2024 7,232 0 View

DsRNA synthesis troubleshooting

Primers designed for dsRNA synthesis: dsPer48F.1: TAATACGACTCACTATAGGGACCCCCTACCCCAACTATCC dsPer48R.1: TAATACGACTCACTATAGGGGTCGCAGAGCATCGTTTCC Control primers (without T7 promoter): AMplicon...

01 January 1970 9,388 1 View