Magnetic Backhausen noise ?

16 April 2024 0 7K Report

When detecting magnetic Backhausen noise in a DC bias field, why do there be two peaks, one large and one small, in a sinusoidal excitation cycle?

Badges
Science topic

More Long Wu's questions See All

Is there any solar electric power plant having the concentrated photovoltaic modules?

The solar photovoltaic (PV) power plant uses commercial (non-concentrated) PV modules which are quite simple in design and reliable. They can work on fixed orientation and don't need the moving...

16 February 2021 3,796 9 View

Whether L version and D version peptidesshould have identical NMR, especially in the state of self-assembly?

Whether L version and D version peptides should have identical NMR, especially in the state of self-assembly have to have identical NMR? How to use HRMS to confirm L version or D version...

01 February 2021 6,756 4 View

Control in microstructure with growth inhibitor?

Dear researchers, I wish to understand the role of grain growth inhibitor in controlling the microstructure of the ceramic pellet. How it controls the growth? Also, I wish to know the grain...

15 January 2021 3,859 3 View

Does behavior (shy vs bold; rare vs abundant) and flock size (small vs large) of bird species play role in niche partitioning among sympatric species?

Sympatric birds may avoid competition via multiple strategies - by different activity period, different diet, different microhabitat etc. Has any one looked into behavior of sympatric birds as...

11 January 2021 9,600 1 View

Buckling of Smart composite plates using FEM ( MATLAB code)?

Can anyone help me with the FEM coding for Buckling of composite plates using the FSDT or HSDT - Source or the helping material (textbook, research paper etc) - Geometric stiffness matrix...

03 January 2021 3,059 3 View

How can I downgrade Networkx 2.5 to 2.3 version?

When I run the command according to the GROMACS tutorial, I got the below result This script has been tested with NetworkX 2.3, and 2.4 is buggy. Please install version 2.3 for best...

27 December 2020 4,699 3 View

Protocol for in vitro cytokine stimulation of immunized CD8+ T cells?

Hi, everyone: I want to determine whether IL-2 and IL-15 have different effects on immunized CD8+ T cell effector function. In this study, I immunize WT mice with peptide on day 0 and 7, and...

02 December 2020 9,413 3 View

Optimization technique in ball mill?

Hi all, I wish to know about a common problem faced by most of the researchers who are dealing with ceramic materials that my ceramic powder is sticking with the balls after the operation. can...

02 December 2020 8,232 3 View

Do I need to run a factor analysis on all the items used in the SEM to solve the multicollinearity issues?

Respected researchers, I conducted a SEM including 5 variables (two independent variables , two mediators, and a dependent variables), the correlations between these variables range vary from...

01 December 2020 1,338 5 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

How two melting peaks in DSC of polypropylene can be merged into one crystallization peak?

The figure shows DSC cooling (blue) and 2nd heating (green) curves (step: 10 K/min) for a commercial sample supplied as Atactic Polypropylene (APP). The heating curve illustrates two major...

03 March 2021 5,857 3 View

I got 02 moderator values defining Johnson-Neyman significance regions. Is it an error?

Hi everyone, I am conducting research for my Master's thesis. I am using PROCESS by Johnson-Neyman to analyze my Moderator model. I test the relationship between Public Service Motivation and...

03 March 2021 2,350 2 View

What are the most reliable approaches to extract key continuous frames from a video, with complete automation?

I have an input video, of skin (from a microscope that means it is magnified such that blood capillaries are visible). The idea is to extract 15 sec of continuous frames from a video of 1 min,...

02 March 2021 2,735 2 View

Issues with Permeabilization during Flow Cytometry?

Hello Everyone. Currently I am working to characterize macrophages in the myocardium after ischemia-reperfusion injury in rats. Due to the low total cell number isolated from rat hearts I can...

01 March 2021 3,867 3 View

What do I do with DLS peaks that are from the buffer?

I'm looking at the aggregation of my protein sample using DLS. Unfortunately, my buffer (20mM HEPES) also results in a set of peaks. These are at approximately 1 and 1000 d.nm. The lowest peak...

01 March 2021 9,015 2 View

What information can be had from raman at higher wavenumber?

i have recorded raman spectra of strontium oxide thin film. the spectra were recorded in the range 400 to 4000 cm-1. i have reference to peaks upto 1000cm-1. but i couldn't find literature for...

26 February 2021 2,499 1 View

Can anyone share his experience regards Smoothing in origin?

I am working on TiO2 composite material and the results of XRD have a lot of small/junk peaks and while I apply a smooth filter in Origin then the other characteristics peaks disappear so anyone...

26 February 2021 8,183 3 View

What are the patterns of human behavior that lead to COVID-19 infections?

Does data from contact tracing help in establishing patterns of behavior and social interactions that lead to infections? There are cases here in the Philippines where patients have no travel...

25 February 2021 9,002 13 View

How can I find a Raman spectrum wavenumber corresponding to what compound?

I have several Raman spectra with very distinct peaks at certain wavenumbers, such as 277, 359, 466, 583, 623, 686, and 795cm-1. How can I identify them to what compound(s)? The RRUFF and others...

24 February 2021 363 3 View

Genescan gives 3 peaks instead of one?

Hi all, I am doing a genescan analysis for a deleted exon in the patient sample. The amplified region is 215 bp. In the patient sample because of homozygous deletion, no peak is observed while in...

23 February 2021 5,645 1 View