I want know is there any code/program which give the count of Vehicle (Moving object) in matlab?

I have completed my noise monitoring and videography ( for traffic volume count) survey ,And I just want to count vehicles moving on road , So let me know is there any code or program in MATLAB to...

24 December 2020 3,316 1 View

One way or Two way ANOVA?

Dear All, I have one dependent variable and three independent variables and wanted to apply ANOVA as a measurement. However these variables do not have any levels or categories. Please suggest...

01 December 2020 2,069 8 View

How to Identify the tuples fall in False Negatives in Confusion Matrix?

All metrics to measure predictability are simply depend(Negatively) on False Negatives(FN) as well as False Positives(FP). Is there any way of knowing who(Instances/Tuples) went to FN basket as...

08 November 2020 192 3 View

Here we are fabricating Perovskite solar cell in air atmosphere, even for standard cell also not getting PCE more than 1.5% but in reports PCE is 15%?

Hi, I am PhD student working on Perovskite solar cells (PSCs), I have fabricated standard cell (FTO/C-TiO2/M-TiO2/CH3NH3PbI3/Spiro-OmeTAD/Ag) in air atmosphere. but i am not getting any...

06 October 2020 8,168 8 View

I want to simulate a VAR model. How do I choose the coefficients to ensure stability?

I know how to compute eigenvalues to test stability. The question If i have for example a 10 node model with 5 lags, how do i choose stable parameters without just guessing.

06 October 2020 5,238 6 View

Best techniques available for the VOCs adsorption by MOFs?

I am very new to MOF-field. I really need your help, can anybody please suggest me which is a simple and best technique to do VOCs adsorption studies for MOFs? In our lab we have GC-MS and my big...

05 October 2020 8,874 2 View

The ratio of hypocholesterolemic/hypercholesterolemic (h/H) fatty acids?

The following equation is generally used for the calculations of the ratio of hypocholesterolemic /hypercholesterolemic (h/H) fatty acids, or h/H fatty acids index (Santos-Silva et al. 2002;...

24 September 2020 9,939 5 View

Stagetips for desalting small molecules (not peptides)?

I work with derivatized neurotransmitter molecules. I was using C-18 SPE cartridges previously for desalting them before LC-MS, but now I would like to adopt in-house made stagetips. These are a...

22 September 2020 4,854 6 View

How to design a Spaceborne Antenna for HEO (Highly elliptical orbit) satellites? What types of Antenna are useful for this purpose?

How to design a Spaceborne Antenna for HEO (Highly elliptical orbit) satellites? What types of Antenna are useful for this purpose?

29 April 2020 9,604 1 View

Will three missing nucleotides on the 3' end of the forward primer result in no annealing?

Hello everyone, I ordered forward and reverse primers for oligo annealing for guided RNA cloning. Instead of this primer (5' CTTCGCTAGAGGCGTGGCCAGGGG 3'), I ordered this...

25 March 2020 551 5 View

error in running a model in Abaqus

Excessive rotation of nodes in node set ErrNodeExcessRotation-Step1

17 August 2021 0 0 View

error in modelling model in Abaqus

Excessive rotation of nodes in node set ErrNodeExcessRotation-Step1

17 August 2021 0 0 View

MGL tools

20 June 2021 0 0 View

i have some problem with chtMultiRegionSimpleFoam

--> FOAM FATAL ERROR: Maximum number of iterations exceeded From function Foam::scalar Foam::species::thermo::T(Foam::scalar, Foam::scalar, Foam::scalar, Foam::scalar (Foam::species::thermo::*)(Foam::scalar, Foam::scalar) const, Foam::scalar (Foam::species::thermo::*)(Foam::scalar, Foam::scalar) const, Foam::scalar (Foam::species::thermo::*)(Foam::scalar) const) const [with Thermo = Foam::hConstThermo >; Type = Foam::sensibleEnthalpy; Foam::scalar = double; Foam::species::thermo = Foam::species::thermo >, Foam::sensibleEnthalpy>] in file /home/ubuntu/OpenFOAM/OpenFOAM-4.1/src/thermophysicalModels/specie/lnInclude/thermoI.H at line 66. FOAM aborting #0 Foam::error::printStack(Foam::Ostream&) at ??:? #1 Foam::error::abort() at ??:? #2 Foam::heRhoThermo >, Foam::sensibleEnthalpy> > > >::calculate() at ??:? #3 Foam::heRhoThermo >, Foam::sensibleEnthalpy> > > >::correct() at ??:? #4 ? at ??:? #5 __libc_start_main in "/lib/x86_64-linux-gnu/libc.so.6" #6 ? at ??:?

24 March 2021 0 0 View

How to compare two groups with only two measurements?

Hiiiii everyone! I have an enquiry on statistical analysis. I was looking for many forum and it's still cannot solve my problem. I want to compare means of two groups of data but only with two...

03 March 2021 8,796 3 View

Why should we choose deep learning to machine learning? Why is CNN better for image classification? Can I get Typical Answer?

What Characteristics makes CNN work better?

03 March 2021 1,458 4 View

What are some of the research gaps in machine learning and artificial intelligence in africa?

i would to know some of the research gaps in the artificial intelligence field in most african countries.

03 March 2021 6,145 3 View

Anyone plz suggest relevant topic for research in image processing+Deep learning.?

I have selected brain tumor images ...but now found that already lots of research done n this topic.

03 March 2021 5,774 3 View

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10?

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...

03 March 2021 1,401 3 View

How to increase a model accuracy ?

dear community, my model is based feature extraction from non stationary signals using discrete Wavelet Transform and then using statistical features then machine learning classifiers in order to...

03 March 2021 6,994 5 View