it is a gram negative bacteria. Gram negative bacteria do not retain the crystal violet dye and turn red or pink when safranin is added. But what exactly is the color or other distinguishing features of E. carotovora when differentiated with other gram negative bacteria?
The best is to amplify the 16S DNA sequence with universal primers for bacteria and send it to sequence. After a Blast analysis you will know what you have. Cheaper, faster and mor precise.
I agree with Alexandro. But you can also use media to narrow down before the PCR and sequencing. This is crucial if you are dealing with so many isolates.To identify Erwinia sp use Miller-Scroth medium modified by replacement of most of the agar with sodium polypectate. Add NaOH and MOPS (3-(N-morpholono)propanesulfonic acid) to raise the pH and buffer the medium. Pectolytic erwinias will appear as pink to orange colonies located in deep pits. Non pectolytic erwinia will form pink-orange colonies with no pits. Pseudomonas spp will form green colonies without pits or will not grow on the medium. Microbact kit can also be used to confirm further that it is Erwinia sp. DNA extraction, PCR and sequencing can then follow.
It's name is not Erwinia carotovora anymore, since 2003, its name has changed to Pectobacterium carotovorum.
For fast and reliable detection, it's better you use PCR with specific primer such as Y1 & Y2
Y1: 5'TTACCGGACGCCGAGCTGTGGCGT 3
Y2: 5'CAGGAAGATGTCGTTATCGCGAGT '3
Pectobacterium (new name for E. carotovora) is a pectinolytic bacterium. I agree with Alexandro and Reza that to have a final answer sequencing of the 16S or amplification with specific primers like Y1/Y2 are convenient, but if you have several isolates, a quick test of pectinolytic activity will give a rapid answer. A specific medium called CVP was devised for that purpose (Two new effective semiselective crystal violet pectate media for isolation of Pectobacterium and Dickeya. By: Helias, V.; Hamon, P.; Huchet, E.; et al.
PLANT PATHOLOGY Volume: 61 Issue: 2 Pages: 339-345 Published: APR 2012 ).
Alternatively you can let grow your bacteria on a minimal medium supplemented with pectate as a carbon source and reveal the pectinolytic activity by floading your plates with 1% CTAN or 10% CuSO4.
good luck
Frédérique
And we can use soloution of potato by 10.6 cfu and culture them in EMB media and chose black-green colonies. this is so so easy and fast
- Badges
- Science topic
- Similar topics
- Biological Science
- Microbiology
- Microorganisms