Ask for help about wannier90, hopping matrix elements are not complex conjugate?

Dear All, I calculate band structure and hopping matrix of monolayer Graphene by using wannier90-2.0.1. There are two atoms in one unit cell, the following is input information : INCAR :...

26 February 2020 4,885 1 View

How to calibrate a T/C CO2 sensor in an air-jacketed CO2 incubator without an independent CO2 sensor?

I have an air-jacketed CO2 incubator and I need to calibrate its thermal conductivity CO2 sensor. However, I do not have a CO2 sensor that is independent of the incubator to measure the CO2...

31 January 2020 8,758 1 View

What is a good procedure to identify if the CO2 incubator is the source of contamination in my cell cultures?

I have read some vague descriptions about how to screen the CO2 incubator as the source of contamination. I saw recommendations to leave a plate of cell culture media in the incubator and view it...

12 January 2020 8,639 2 View

Have problems in insert sgRNA into lenticrispr v2 vector?

my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol,...

28 December 2018 4,592 3 View

How to measure the perceived contradiction of "need certain resource yet cannot acquire it"?

How to measure the perceived contradiction of "need certain resource yet cannot acquire it"?

28 March 2018 6,378 2 View

Can I run a multiple regression with 150 cases altogether with hormones as independent variables to predict birth weight?

12 October 2016 6,081 4 View

What is the proper stimulation point (dosage and time) for VSMC proliferation?

20 February 2015 2,729 1 View

How do you distinguish between human and mouse cells in mouse sections?

Does anyone know good antibodies to distinguish between human epithelial cell and mouse cells in mouse liver sections by IHC staining? Thank you for your answers.

16 November 2014 4,670 3 View

Do you starve PBMCs before LPS stimulation?

I'm maintaining mouse PBMCs in 10% FBS for a LPS stimulation experiment. I'm going to plate the cells in 96-well plate and treat them with LPS for ELISA. Just wonder if you guys starve the cells...

07 November 2014 9,702 5 View

Why is there so much discrepancy between the lanes when using the BCA method determine to protein concentration?

23 September 2014 3,838 7 View

Is There Any Feasible Method To Test Fluorescent Compounds Other Than Fluorescence Spectrometers ??

Is There Any Feasible Method To Test The Efficiency Of Fluorescent Compounds Other Than UV Spectrometers ? Suggestions Would Be Appreciated !

02 March 2021 5,785 3 View

Which SAR dataset to use for generating coherency matrix and performing target decomposition (Description) ?

Working on chandrayaan-2 DFSAR data, there are three datasets available: 1) Slant range image data product: The slant range complex image file. Each pixel is represented by two 4-byte floating...

02 March 2021 8,481 3 View

How UAV or drone can be beneficial to better estimate crop yield?

As we know, crop yield estimation has been done traditionally with farmer's expert knowledge, deductive sampling in representative areas, and remote sensing with satellite imagery. Farmer's Expert...

01 March 2021 3,468 3 View

Which bacteria are suitable for quorum sensing screening?

I want to find a quorum sensing inhibitor from plant extracts. Klebsiella pneumoniae, Moraxella catarrhalis, Staphylococcus aureus, and Streptococcus pneumoniae. I looked for these strains...

01 March 2021 7,675 3 View

What is your preference for journals for publishing in the field of Hyperspectral Imaging or Remote sensing?

I believe that we need to share our experience in publishing in the field of Hyperspectral Imaging or remote sensing? What is the best journal that you publish with? What is the worst experience...

23 February 2021 3,411 4 View

How to use Remote sensing and GIS applications for mapping the available medicinal plants within the locality/municipality?

Hello, I'm very interested in mapping and managing the conservation of the Philippine traditional medicinal plants, in which I think is very helpful in the field of medicine for further analysis...

21 February 2021 374 5 View

How to discriminate between Sentinel-2 Level-2A Product Discriminators?

According to the Sentinel-2 user guide here (https://sentinel.esa.int/web/sentinel/user-guides/sentinel-2-msi/naming-convention), the compact naming convention is arranged as...

21 February 2021 5,919 9 View

Are cloud points able to identify tree species?

Hello Dears My goal is to classify dense forest tree species using drone images. Is it possible to classify dense cloud points? If yes, in what way and in what software? Thankful

15 February 2021 3,475 3 View

What is/are the best ML classifier(s) for Sentinel2 images?

Hi I am trying to segment a sentinel2 image. At this stage, I want to run a binary classifier that assigns each pixel to either farm or non-farm pixel. For this purpose, I have 4 10m bands...

15 February 2021 3,596 9 View

How to increase coupling range (distance between reader and sensor coils) in LC resonance circuit?

Hello great researchers, I am working on a wireless pressure monitoring project where sensing part is actually an LC resonance sensor and I am using a planar coil as a reader to get wireless...

11 February 2021 4,148 5 View