I have a large text file. How can i extract text between specific text pattern and print it to another file..is there any script for it in perl or python
You can use regex. Both python and perl are very good on it.
import re
m = re.match(r"PATTERN", textfile.content)
m.groups() will have your patterns matches
m.start() the position where the pattern starts
m.end() the position where the pattern ends
More help can be found at https://docs.python.org/2/library/re.html
hi
in python
import re
f1=open("file location", r);
f2=open("file location",w); % to write data
for t in f1:
str1=str(t).replace("\n","");
if re.search("what is the patteren",str1):
f2.write(str1);
Hi,
Is the subsequence in the same line ore you need more general code. If it is in one line you may use the split() function with your patterns as the delimiters. If you need to apply it to many files it is also easy. Usually, such custom cede does not exist entirely in script but you may combine yours easily.
Dusan
This depends on how large of a file are we talking here. If this is a small file, look at any regular expression solution. grep, awk, any-programming-language with regex support should work. But if the file is massive and response time is critical, you might have to dirty your hands with something like Hadoop.
you could parse the text file in a string variable, In C++ it should be something like this.
#include
#include
using namespace std;
string pattern = "GCTA";
// assuming this as data in text file
string sequence = "CGACTGTAGCTAGCTATGCTCTG";
size_t position = sequence.find(pattern);
string subString = sequence.substr(position); // This contains your sub string
You cannot get a answer before you paste a part of that file and explained what do you want to extract. These general answers won't help you a lot.
- Badges
- Science topic
- Similar topics
- Computer Science and Engineering
- Programming Languages
- Python