7 Questions 19 Answers 0 Followers
Questions related from Termeh Hesam Mahmoudinejad
I have a shape file containing almost 3000 points and a delimited text layer with almost 500 points. What I want to do is to calculate the distance between each 500 points and the nearest point to...
07 July 2020 4,030 10 View
I'm doing qPCR targeting 16s rRNA with the primers 337F and 518R. The standard curve looks fine. The problem is the melting peak of the environmental samples of unknown bacterial composition. They...
08 May 2019 6,772 16 View
I have some geospatial data points (X and Y in decimal degrees) and the concentrations of a certain parameter for each point. I want to create a heat map to show the density of the concentrations...
01 May 2019 9,226 9 View
I did the plasmid extraction, and ran the PCR with my primers... Then, I did the magnetic bead purification to purify the PCR product. In the attached picture you can see smearing in the lane on...
05 April 2019 9,687 6 View
I am doing qPCR assay targeting intI1 genes, with some waste water treatment plant DNA samples. I used the primer pairs HS463a (CTGGATTTCGATCACGGCACG), HS464 (ACATGCGTGTAAATCATCGTCG), IntI1F165...
27 February 2019 8,492 9 View
The 16s rRNA gene is quantified in some surface water samples. But there was always amplification in the no template controls (which contain nuclease free water instead of DNA). The problem is not...
01 January 1970 6,221 4 View
Hello, I’m beginner in doing PCR assay. So, the question is very basic. I did a pcr test and after runing the gel electrophoresis, I saw the target gene got amplified. I was told to use the DNA...
01 January 1970 3,536 4 View
