6 Questions 7 Answers 0 Followers
Questions related from Ranjan Sarmah
Suppose I want to know the gene silencing activity of the below mentioned siRNA: CATATTCACATTCTGCTGTTT Is there any online software to find the gene silencing activity of a particular siRNA sequence?
12 January 2015 5,081 3 View
How can I convert the nucleotide sequence into binary pattern? Nucleotide sequence (AAUAUGUUAAUUGAUUUAU).
05 January 2015 2,863 4 View
Suppose I want want to design ANN and SVM model for designing siRNA against plant pathogen. Is it possible to take Hueskan (2431) dataset for testing and training purposes because Huesken dataset...
27 December 2014 4,113 2 View
A Data set of siRNA...
23 December 2014 5,309 2 View
I have a Dataset of siRNA as showing...
23 December 2014 5,749 2 View
How to classify siRNA sequences and how to train a dataset using SVM. Also what would be the best software for doing this. Whether SPSS v 16 support SVM or not. If yes please explain how to...
20 December 2014 9,938 4 View