Ranjan Sarmah

4 Questions 4 Answers 0 Followers

Questions related from Ranjan Sarmah

Can it be possible to find gene silencing activity of a particular siRNA sequence?

Suppose I want to know the gene silencing activity of the below mentioned siRNA: CATATTCACATTCTGCTGTTT Is there any online software to find the gene silencing activity of a particular siRNA sequence?

12 January 2015 5,062 3 View

What is the method for conversion of nucleotide sequence into binary pattern?

How can I convert the nucleotide sequence into binary pattern? Nucleotide sequence (AAUAUGUUAAUUGAUUUAU).

05 January 2015 2,804 4 View

Is it possible to use the Huesken Dataset when designing siRNA against plant pathogens?

Suppose I want want to design ANN and SVM model for designing siRNA against plant pathogen. Is it possible to take Hueskan (2431) dataset for testing and training purposes because Huesken dataset...

27 December 2014 4,102 2 View

How can I convert siRNA sequences into mono-nucleotide i.e a vector of 4?

A Data set of siRNA...

23 December 2014 5,283 2 View