2 Questions 5 Answers 0 Followers
Questions related from Qasim Raza
Hi, I want to display chromosomal distribution of a gene family using MapInspect tool (http://mapinspect.software.informer.com/). But i don't know how to create MAP and PWD files. I gone through...
11 February 2018 8,317 3 View
I have a huge fasta format file(>225 Mb) containing nucleotide sequences. These are in the following format >234 12 132 AGGCTTTCCGAGAATATACCAGAGCT >321 45 765 ACCTGATATCGAGATCATAGAC and...
07 October 2016 5,515 2 View