Olivia Szulikowska

3 Questions 6 Answers 0 Followers

Questions related from Olivia Szulikowska

Bacteria still motile after autoclaving, although they cannot grow on agar media?

As a part of one of my R&D projects, I had to examine the effect of a set of industrial co-products on the growth of a single microalgal species. I had to prepare (6) flasks containing 100...

27 November 2018 8,683 12 View

Best way to measure microalgal growth in a non-clear culture?

I am struggling to find a method to assess the suitability of various carbon sources due to the fact that the carbon sources I am dealing with are quite thick and not clear. I have thought of...

01 November 2018 7,341 4 View

Will the self-complementarity value of the reverse primer be an issue ?

The set of PCR primers is as follows: (determined using blast, Specificity:Alteromonas) Forward primer AACAACACGCATTACACGCC Reverse primer GTGGCCAAGTGCCATACTCT Self-complementarity: 2.00 &...

07 March 2017 9,047 3 View