3 Questions 6 Answers 0 Followers
Questions related from Olivia Szulikowska
As a part of one of my R&D projects, I had to examine the effect of a set of industrial co-products on the growth of a single microalgal species. I had to prepare (6) flasks containing 100...
27 November 2018 8,692 12 View
I am struggling to find a method to assess the suitability of various carbon sources due to the fact that the carbon sources I am dealing with are quite thick and not clear. I have thought of...
01 November 2018 7,349 4 View
The set of PCR primers is as follows: (determined using blast, Specificity:Alteromonas) Forward primer AACAACACGCATTACACGCC Reverse primer GTGGCCAAGTGCCATACTCT Self-complementarity: 2.00 &...
07 March 2017 9,058 3 View