Mohamed Galal | Beginner

Mohamed Galal

3 Questions 2 Answers 0 Followers

Questions related from Mohamed Galal

Can any one tell me can i dissolve the hapten NP-OVA in sterile water and mix it with Alum to inject it intraperitoneally in mice ?

immunization with NP-OVA hapten antigen

03 November 2021 5,215 4 View

What is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription (GAGTTCCAGGTCACTGTCACTGGCTCAGGGA) ?

GAGTTCCAGGTCACTGTCACTGGCTCAGGGA

03 August 2020 183 8 View

What is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?

what is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?

14 July 2020 7,651 3 View