4 Questions 2 Answers 0 Followers
Questions related from Mohamed Galal
i have sorted anti-NP specific plasma cells from bone marrow of C57BL/6 mice at certain times after immunization with variable counts and isolated total RNA using TRIZOL method for RT-PCR using...
06 August 2024 8,835 1 View
immunization with NP-OVA hapten antigen
03 November 2021 5,239 4 View
GAGTTCCAGGTCACTGTCACTGGCTCAGGGA
03 August 2020 248 8 View
what is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?
14 July 2020 7,712 3 View