Mohamed Galal

4 Questions 2 Answers 0 Followers

Questions related from Mohamed Galal

How much total RNA concentration to be extracted from sorted plasma cells from bone marrow of C57BL/6 mice for RT-PCR ?

i have sorted anti-NP specific plasma cells from bone marrow of C57BL/6 mice at certain times after immunization with variable counts and isolated total RNA using TRIZOL method for RT-PCR using...

06 August 2024 8,794 1 View

Can any one tell me can i dissolve the hapten NP-OVA in sterile water and mix it with Alum to inject it intraperitoneally in mice ?

immunization with NP-OVA hapten antigen

03 November 2021 5,220 4 View

What is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription (GAGTTCCAGGTCACTGTCACTGGCTCAGGGA) ?

GAGTTCCAGGTCACTGTCACTGGCTCAGGGA

03 August 2020 196 8 View

What is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?

what is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?

14 July 2020 7,660 3 View