Hira Gul

2 Questions 3 Answers 0 Followers

Questions related from Hira Gul

Why UCSC genome browser is not browsing a designed primer sequence for PIK3R1 gene? Forward CCAACAACGGTATGAATAACCATAT Reverse ATCCAGCACCCACAGTTCTC. ?

I picked a primer sequence ,designed by the author, for my PCR from a published paper. The issue is: UCSC Insilico Pcr is not browsing that sequence, although a detailed study is done on these...

18 April 2022 8,126 6 View

What are the reasons of non specific primer binding/amplification in PCR reaction?

I am facing issue of appearance non specific bands in my PCR reaction.

01 February 2022 3,555 7 View